Open Access

Chromosome 9p21.3 polymorphism in a Chinese Han population is associated with angiographic coronary plaque progression in non-diabetic but not in type 2 diabetic patients

  • Wei Wang1, 2,
  • Wenhui Peng2,
  • Xianling Zhang2,
  • Lin Lu1, 2,
  • Ruiyan Zhang1,
  • Qi Zhang1,
  • Lingjie Wang1, 2,
  • Qiujing Chen2 and
  • Weifeng Shen1, 2Email author
Contributed equally
Cardiovascular Diabetology20109:33

https://doi.org/10.1186/1475-2840-9-33

Received: 2 July 2010

Accepted: 6 August 2010

Published: 6 August 2010

Abstract

Background

We sought to explore the association of variant rs1333049 on chromosome 9p21.3 with coronary artery disease (CAD) and angiographic plaque progression in non-diabetic and type 2 diabetic patients.

Methods

Genotyping and quantitative coronary angiography (QCA) were performed in 2046 Chinese Han patients (1012 diabetic cases) undergoing coronary angiography; 430 of them received repeat angiographic studies at 1-year follow-up.

Results

CC genotype at rs1333049 on chromosome 9p21.3 was associated with CAD (unadjusted OR 1.524, p = 0.001 and adjusted OR 1.859, p = 0.005, respectively). However, CC genotype had no magnified association with CAD in diabetic patients (OR 1.275, p = 0.150) compared with non-diabetic counterparts (OR 1.446, p = 0.020) after adjusting for conventional risk factors. During angiographic follow-up, non-diabetic patients (n = 280) had significant decrease in minimal lumen diameter and increase in percent diameter stenosis among the three genotypes (p = 0.005 and p = 0.038, respectively), demonstrating that CC or GC genotype carriers had a more severe plaque progression than GG genotype carriers. In patients with type 2 diabetes (n = 150), although plaque progression was more severe than that in non-diabetic counterparts, no relations existed between plaque progression and genotypes. Rs1333049 was an independent determinant of plaque progression for non-diabetic (OR 3.468, p = 0.004 and OR 4.339, p = 0.002 for GC and CC genotype, respectively) but not for diabetic patients (OR 0.529, p = 0.077 and 0R 0.878, p = 0.644 for GC and CC genotype, respectively).

Conclusions

This study demonstrates a significant association of homozygous CC genotype of rs1333049 on chromosome 9p21.3 with CAD in Chinese Han population. Rs1333049 polymorphism is an independent determinant for coronary plaque progression in non-diabetic but not in type 2 diabetic patients.

Background

Recent genome-wide scanning has implicated chromosome 9p21.3 as a novel locus conferring susceptibility to coronary artery disease (CAD), myocardial infarction and cardiac death [15], which is independent of traditional risk factors including gender, age, obesity, smoking, hypertension and hyperlipidemia [6, 7]. Several studies showed that chromosome 9p21.3 was a vital genetic region with different independent loci of SNPs related to either diabetes or CAD [811]. The risk of CAD associated with 9p21 variant was increased in the presence of poor glycemic control in type 2 diabetes [8]. Also, as one of the risk equivalents of CAD, patients with diabetes often had an increased atherosclerotic burden and inflammatory process in the coronary artery tree [1214]. Thus, we hypothesized that certain locus on chromosome 9p21.3 might have its effect in a common pathway of diabetes and CAD. In a recent study, Chen et al revealed no association between coronary atherosclerotic plaque progression and polymorphism on chromosome 9p21.3 in Caucasian population [15]. Admittedly, this cross-section study was not designed to seek possible association of 9p21.3 with CAD in a special diabetic population. Furthermore, genetic effect of variant rs1333049 on chromosome 9p21.3 on angiographic coronary disease progression in Chinese patients remains unclear. Therefore, the present case-control study was conducted to examine whether this locus influences angiographic plaque progression in Chinese Han non-diabetic and type 2 diabetic patients.

Methods

Patients

The study protocol was approved by the hospital Ethics Committee, and written informed consents were obtained from all subjects.

The study population consisted of 2046 Chinese Han patients (1012 diabetic and 1034 non-diabetic cases) undergoing coronary angiography between March 2004 and December 2007 for the evaluation of suspected or established CAD (luminal diameter narrowing ≥50%); 430 of them received repeat angiography at 1-year follow-up. Type 2 diabetes was defined as a fasting plasma glucose level ≥7.0 mmol/L or non-fasting plasma glucose level≥11.1 mmol/L, or taking oral hypoglycemic drugs or receiving parenteral insulin therapy. Patients with type 1 diabetes were excluded by measuring C peptide, and excluded were also those with chronic viral or bacterial infection, tumor, or immune system disorders. Diagnosis of hypertension was based on the presence of elevated systolic (≥140 mmHg) and/or diastolic (≥90 mmHg) blood pressure, or current use of antihypertensive medications for one year before admission. Patients were diagnosed as hyperlipidemia if serum levels of total cholesterol (TC)>5.7 mmol/l (220 mg/dl), triglycerides (TG) >1.7 mmol/l (150 mg/dl), low-density lipoprotein cholesterol (LDL-C) >3.64 mmol/L (140 mg/dl), or high-density lipoprotein cholesterol (HDL-C) <0.91 mmol/L (35 mg/dl).

Coronary angiography and quantitative analysis

Coronary angiography was performed using standard Judkins techniques or through radial approach, and all major coronary arteries were carefully imaged on at least two orthogonal views. Quantitative coronary analysis (QCA) was performed (TERRA, GE, USA) by two experienced interventional cardiologists, who were unaware of clinical information of the patients. For those with coronary angiography at baseline and 1-year follow-up, all coronary arteries intervened with percutaneous coronary intervention (PCI) were excluded to avoid inclusion of post-PCI neointimal hyperplasia or restenosis [16]. The coronary artery segments analyzed included all those plaques with a reference diameter ≥ 1.5 mm and a stenosis ≥ 20% at baseline and those with new lesions at follow-up in non-PCI intervened artery. Using the outer diameter of the contrast-filled catheter as the calibration, the minimal lumen diameter (MLD) in diastole was measured from multiple projections. Atherosclerotic plaque progression was diagnosed if one of the following criteria was met: (1) ≥10% diameter reduction of a pre-existing stenosis ≥50%; (2) ≥30% diameter reduction of a stenosis <50%; (3) progression of any stenosis to total occlusion, or (4) development of a new stenosis ≥30% in a previously normal segment [17]. A new coronary lesion was defined as a stenosis that was not apparent on the initial angiogram or was <20% in diameter stenosis but that narrowed by≥0.4 mm in MLD at the follow-up angiogram [18]. Coronary artery score was calculated from per-patient average of the MLD of all the measured segments in observed coronary artery, and cumulative coronary obstruction was the sum of all percent diameter stenosis in standard index unit (50% = 0.50) [19]. Change of QCA measurements was defined as baseline QCA measurement minus follow-up measurement.

Biochemical investigation

Blood samples were collected after an overnight fasting in all patients and were stored at -80°C. Serum glucose, hemoglobin A1c (HbA1c), insulin levels, blood urea nitrogen (BUN), creatinine, and lipid profiles (TC,LDL-C,HDL-C,TG) were measured (HITACHI 912 Analyzer, Roche Diagnostics, Germany). Serum high sensitivity C-reactive protein (hsCRP) level was determined using a high-sensitivity ELISA kit (Biocheck Laboratories, Toledo, OH, USA) with a linear range of 0.62-119.3 mg/L and an inter-assay CV <7.5%.

Genotyping

Genomic DNA was extracted from peripheral blood leucocytes by standard phenol-chloroform extraction. Genotyping was performed with TaqMan SNP allelic discrimination by means of an ABI 7900HT (Applied Biosystems, Foster City, CA, USA), in 384-well format. The TaqMan Assay kit was purchased from Applied Biosystems (Foster City, CA, USA). Genotypes were determined with the same method as previously described [20], in which primers of rs1333049 polymorphism were TCACTACCCTACTGTCATTCCTCAT and TTGCTTACCTCTGCGAGTGG, and probes were VIC-CAACAGTTCAAAAGCA and FAM-AACAGTTGAAAAGCA. Data were analyzed using the ABI Prism SDS software version 2.1.

Statistical analysis

Continuous variables are presented as mean ± standard deviation, and categorical data are summarized as frequencies or percentages. Normal distribution of continuous variable was evaluated with Kolmolgorov-Smirnov test. For categorical variables, differences between groups were evaluated by the chi-square test. Differences among genotypes were analyzed by one-way analysis of variance (ANOVA) followed by post-hoc analysis (Bonferroni's correction) for comparison between groups. Odds ratios (ORs) of CAD were first estimated by chi-square test and then adjusted by traditional risk factors for CAD including gender, age, hypertension, hyperlipidemia, smoking status and diabetes (all factors with p < 0.05 between CAD and non-CAD in the study population). ORs of covariates determining plaque progression were estimated using a multivariable logistic regression model. A 2-sided probability level of ≤0.05 was considered significant. All analyses were done with SPSS for Windows 13.0 (SPSS Inc, Chicago, Illinois, USA).

Results

Baseline characteristics of the study population

As expected, patients with CAD were older and more male gender, and had more risk factors for CAD including smoking, hypertension, hyperlipidemia and diabetes and higher serum hsCRP level than those without CAD (all p < 0.05; data not shown). Despite similar medical treatments, patients with plaque progression had more diabetes, elevated serum levels of 2 h plasma glucose and hsCRP, and reduced HDL-C than those without plaque progression (Table 1).
Table 1

Baseline clinical characteristics and biochemical assessments of plaque progression study

 

CAD

 

Plaque Progression

(n = 137)

No Plaque Progression

(n = 293)

P

Men/Female (n)

97/40

208/85

0.864

Age (years)

64.13 ± 7.80

65.51 ± 10.13

0.299

Cigarette smoking (%)

61(44.5%)

139(47.4%)

0.604

Hypertension (%)

65 (47.4%)

130 (44.4%)

0.512

Hyperlipidemia (%)

36 (26.3%)

65 (22.1%)

0.466

Diabetes (%)

69 (43.0%)

81 (28.0%)

0.033

BMI (kg/m2)

24.63 ± 3.46

24.05 ± 3.24

0.189

Fasting plasma glucose (mmol/L)

5.49 ± 1.88

5.99 ± 2.00

0.255

2 h plasma glucose (mmol/L)

13.40 ± 4.20

11.29 ± 3.66

0.039

HbA1c (%)

6.79 ± 1.48

6.64 ± 1.43

0.315

hsCRP (mg/ml)

19.35 ± 13.63

11.87 ± 9.22

<0.001

Total cholesterol (mmol/L)

4.77 ± 1.04

4.84 ± 1.16

0.631

Triglyceride (mmol/L)

1.93 ± 1.53

2.02 ± 1.32

0.319

LDL-C (mmol/L)

2.80 ± 0.79

2.84 ± 0.85

0.672

HDL-C (mmol/L)

1.09 ± 0.31

1.27 ± 0.27

0.015

apoA (g/L)

1.22 ± 0.20

1.27 ± 0.22

0.156

apoB (g/L)

0.97 ± 0.22

0.95 ± 0.23

0.674

Lipoprotein (a) (g/L)

0.25 ± 0.18

0.23 ± 0.16

0.422

BUN (mmol/L)

5.49 ± 1.89

5.88 ± 1.65

0.078

creatinine (mg/L)

91.51 ± 23.16

89.78 ± 20.08

0.534

Statin (%)

126 (92.1%)

262 (89.5%)

0.475

ACEI or ARB (%)

114 (83.3%)

231 (79.0%)

0.285

β-blocker (%)

59 (43.1%)

121 (50.9%)

0.448

Antiplatelet (%)

123 (90.1%)

215 (90.3%)

0.656

Insulin (%)

36 (26.2%)

30 (12.7%)

0.069

Oral anti-diabetic drugs (%)

49 (35.7%)

111 (46.5%)

0.144

Data are number (%) and mean ± SD;

Abbreviations: CAD, coronary artery disease; BMI, body mass index; HbA1c, glycosylated hemoglobin; hsCRP, high sensitivity C-reactive protein; HDL-C, high-density lipoprotein cholesterol; LDL-C, low-density lipoprotein cholesterol; BUN, blood urea nitrogen.

Association between rs1333049 polymorphism and CAD

The genotype frequencies of rs1333049 were in Hardy-Weinberg equilibrium in patients with and without CAD (all p > 0.05, data not shown). CC genotype of rs1333049 was associated with CAD in overall patients with unadjusted OR 1.524, 95% CI 1.192-1.949, p = 0.001 and adjusted OR 1.859, 95% CI 1.212-2.852, p = 0.005, respectively (Table 2). Further analysis showed that CC genotype was not significantly associated with CAD in diabetic patients (OR 1.275, 95% CI 0.843-1.930, p = 0.150) compared with non-diabetic counterparts (OR 1.446 95% CI 1.145-1.826, p = 0.020).
Table 2

Multivariable analysis of independent determinants for coronary artery disease in the whole population

Variables

Unadjusted OR (95% CI)

p

Adjusted OR (95% CI)

p

Rs1333049 (GC vs. GG)

1.199 (0.966-1.487)

0.099

1.105 (0.755-1.619)

0.607

Rs1333049 (CC vs. GG)

1.524 (1.192-1.949)

0.001

1.859 (1.212-2.852)

0.005

Gender (male vs. female)

2.534 (2.132-3.011)

<0.001

2.516 (2.107-3.224)

<0.001

Age (years)

2.093 (1.760-2.489)

<0.001

1.952 (1.627-2.341)

<0.001

Hypertension (yes vs. no)

1.589 (1.347-1.875)

<0.001

1.490 (1.251-1.774)

<0.001

Hyperlipidemia (yes vs. no)

1.187 (0.952-1.473)

0.119

1.274 (1.008-1.608)

0.042

Smoking (yes vs. no)

2.242 (1.893-2.655)

<0.001

1.837 (1.527-2.211)

<0.001

Diabetes (yes vs. no)

1.873 (1.571-2.233)

<0.001

1.780 (1.470-2.157)

<0.001

Risk factors which are adjusted include gender, age, hypertension, hyperlipidemia, smoking status and diabetes.

Association between rs1333049 polymorphism and plaque progression

Biochemical measurements and angiographic features with respect to various genotypes are listed in Table 3. White blood cell (WBC) and neutrophile counts were significantly higher in CC genotype carriers. There were no significant differences in changes of MLD, percent diameter stenosis and number of new coronary lesions among the three genotypes in the whole population at follow-up angiography (all p > 0.05) (Table 3). In non-diabetic patients, risk C allele of rs1333049 was related to degree of MLD reduction (0.25 ± 0.49 mm for CC genotype, 0.20 ± 0.35 mm for GC genotype, and 0.05 ± 0.35 mm for GG genotype, respectively, p = 0.005) (Table 4). Similar findings were observed for change of percent diameter stenosis, coronary artery score and cumulative coronary obstruction (p = 0.038, 0.004 and 0.025, respectively). Although diabetic patients had more severe plaque progression than non-diabetic counterparts, no relations existed between plaque progression and genotypes (all p > 0.05) (Table 4).
Table 3

Changes in biochemical and angiographic measurements during follow-up

 

Rs1333049

 
 

GG (n = 122)

GC (n = 200)

CC (n = 108)

p

Change of Biochemical measurements

 

   Total cholesterol (mmol/L)

0.64 ± 1.17

0.41 ± 1.12

0.53 ± 1.14

0.228

   LDL-C (mmol/L)

0.27 ± 0.98

0.24 ± 0.90

0.34 ± 0.86

0.623

   HDL-C (mmol/L)

-0.05 ± 0.49

-0.01 ± 0.22

0.01 ± 0.19 a

0.422

   Triglyceride (mmol/L)

0.41 ± 1.92

0.10 ± 0.86 a

0.16 ± 1.06 b

0.106

   apoA (g/L)

0.10 ± 0.15

0.09 ± 0.17

0.08 ± 0.16

0.029

   apoB (g/L)

0.41 ± 0.37

0.39 ± 0.30

0.40 ± 0.34

0.639

   Lipoprotein (a) (g/L)

-0.01 ± 0.08

-0.02 ± 0.09

-0.01 ± 0.12

0.873

   Fast glucose (mmol/L)

0.39 ± 1.22

0.42 ± 2.48

0.66 ± 1.58

0.487

   HbA1c (%)

0.52 ± 1.54

0.40 ± 1.32

0.27 ± 1.44

0.419

   White blood cells (× 10 9/L)

0.75 ± 2.02

0.92 ± 1.94 a

1.46 ± 1.87 a

0.012

   Neutrophile (× 10 9/L)

0.51 ± 1.64

0.66 ± 1.98

1.13 ± 1.80 a

0.025

   Lymphocyte (× 10 9/L)

0.21 ± 0.66

0.21 ± 0.64

0.29 ± 0.54

0.463

Smoking status

    

   Non-smoker (%)

67 (54.9%)

109 (54.5%)

54 (49.2%)

0.309

   Smoker with cessation (%)

30 (24.6%)

49 (24.5%)

30 (27.7%)

0.474

   Smoker without cessation (%)

25 (20.5%)

42 (21.0%)

24 (23.1%)

0.532

Angiographic features

    

   New coronary lesion

0.09 ± 0.29

0.07 ± 0.26

0.11 ± 0.32

0.385

   Change of MLD (mm)

0.18 ± 0.46

0.26 ± 0.44

0.29 ± 0.50

0.151

   Change of diameter stenosis (%)

-5.14 ± 15.87

-8.82 ± 16.03

-9.38 ± 14.89

0.081

   Coronary artery score (mm)

0.05 ± 0.03

0.16 ± 0.07

0.21 ± 0.11

0.188

   Cumulative coronary obstruction

-0.03 ± 0.09

-0.20 ± 0.13

-0.31 ± 0.21

0.076

MLD, minimal lumen diameter; other abbreviations are listed in table 1

a < 0.05 compared with GG

b <0.01 compared with GG

Table 4

Plaque progression in different genotypes of rs1333049

Non-DM (N = 280)

GG (n = 90)

GC (n = 114)

CC (n = 76)

p

New coronary lesion

0.05 ± 0.22

0.07 ± 0.27

0.11 ± 0.32

0.347

Change of MLD (mm)

0.05 ± 0.35

0.20 ± 0.35 a

0.25 ± 0.49 b

0.005

Change of diameter stenosis (%)

-3.44 ± 13.80

-7.38 ± 13.70

-8.93 ± 14.64 a

0.038

Coronary artery score (mm)

0.01 ± 0.02

0.12 ± 0.04 a

0.16 ± 0.07 b

0.004

Cumulative coronary obstruction

-0.02 ± 0.11

-0.17 ± 0.09

-0.28 ± 0.13 a

0.025

DM (N = 150)

GG (n = 32)

GC (n = 86)

CC (n = 32)

 

New coronary lesion

0.19 ± 0.40

0.07 ± 0.23

0.13 ± 0.34

0.173

Change of MLD (mm)

0.34 ± 0.53

0.39 ± 0.53

0.46 ± 0.56

0.513

Change of diameter stenosis (%)

-9.20 ± 19.61

-10.86 ± 18.77

-10.67 ± 15.74

0.908

Coronary artery score (mm)

0.14 ± 0.07

0.22 ± 0.11

0.29 ± 0.15

0.152

Cumulative coronary obstruction

-0.05 ± 0.10

-0.25 ± 0.18

-0.36 ± 0.27

0.770

MLD, minimal lumen diameter.

a < 0.05 compared with GG

b <0.01 compared with GG

Determinants of plaque progression

Multivariable logistic regression analysis revealed that gender (male), hypertension, genotypes carrying allele C, low HDL-C and high hsCRP were independently associated with plaque progression in non-diabetic patients during 1-year follow-up (OR 3.468 95% CI 1.504-8.000, p = 0.004 for GC genotype and OR 4.339 95% CI 1.740-10.821, p = 0.002 for CC genotype). Meanwhile, gender (male), age, hyperlipidemia, smoking and high hsCRP, but not risk genotype of rs1333049, were independent determinants of plaque progression in diabetic patients (Table 5).
Table 5

Multivariable logistic regression analysis of independent determinants for plaque progression

 

HR

95% CI

p

 

HR

95% CI

p

Non-diabetes

   

Diabetes

   

rs1333049 (GC vs. GG)

3.468

1.504-8.000

0.004

 

0.529

0.685-1.474

0.077

rs1333049 (CC vs. GG)

4.339

1.740-10.821

0.002

 

0.878

0.278-2.814

0.644

Gender (male vs. female)

2.912

1.184-7.161

0.020

 

1.807

1.615-3.100

0.007

Age (y)

0.993

0.914-1.025

0.051

 

0.932

0.876-0.995

0.027

Hypertension

2.129

1.066-4.251

0.032

 

2.287

0.840-6.223

0.105

Hyperlipidemia

2.110

0.732-4.148

0.324

 

6.057

1.922-22.145

0.003

Smoking

1.301

0.638-2.656

0.469

 

3.165

1.008-9.938

0.048

Triglyceride

0.880

0.601-1.298

0.886

 

1.130

0.580-2.119

0.720

Total cholesterol

0.531

0.247-1.429

0.528

 

0.431

0.254-1.116

0.077

LDL-C

1.422

0.497-2.104

0.701

 

1.749

0.556-2.599

0.378

HDL-C

0.471

0.106-0.877

0.030

 

0.214

0.005-0.915

0.037

Creatinine

1.104

0.975-1.156

0.226

 

1.009

0.989-1.029

0.361

Baseline hsCRP

1.302

1.115-1.522

<0.001

 

1.283

1.211-1.309

<0.001

Use of statins

1.401

0.644-3.492

0.562

 

1.709

0.590-4.952

0.317

BMI

1.028

0.925-1.143

0.608

 

1.025

0.889-1.181

0.734

Abbreviations are as in Table 1.

Discussion

This study demonstrates that SNP of rs1333049 on chromosome 9p21.3 increases the susceptibility to CAD in Chinese Han population and confers a magnified risk of coronary plaque progression in non-diabetic patients.

Several genome-wide association studies have shown that different genetic variations on chromosome 9p21.3 were associated with increased risk of diabetes, CAD and sudden cardiac death in the general population [2, 810]. As one of the risk equivalents of CAD, diabetes increased atherosclerotic burden and inflammatory process in the coronary artery tree [1214]. Doria et al reported an interaction between poor glycemic control and 9p21 locus on risk of CAD in type 2 diabetes [8]. However, we observed that homozygous CC genotype of rs1333049 was not strongly associated with CAD in diabetic population in this study, which was in accordance with the findings from a prospective meta-analysis that no interaction existed between diabetes and rs1333049 polymorphism in CAD development [7]. Similarly, there was a magnified risk of C allele for coronary plaque progression in non-diabetic but not in diabetic patients, implying that polymorphism on chromosome 9p21 might have effects on CAD development in a novel biological pathway other than interaction with diabetes or glucose metabolism.

Genetic variation on chromosome 9p21 has been reported to be associated with progression of carotid but not coronary atherosclerosis in Caucasian population [15, 21]. Besides, specific polymorphisms in the chromosome 9p21.3 region that were shown to be associated with CAD in genome-wide analyses might not be related to clinical and angiographic outcomes after implantation of drug-eluting stents in the coronary arteries [22]. Thus, this study was the first to show an association of SNP on chromosome 9p21.3 with CAD and angiographic plaque progression in a special population. In addition, variant at chromosome 9p21 was associated with recurrent myocardial infarction and cardiac death after acute coronary syndrome, serving as a predictive factor of perioperative myocardial injury after coronary artery bypass graft surgery [23, 24]. Taken together, this genetic factor might partially increase the risk of CAD by promoting atherosclerosis development or plaque instability.

The high risk of haplotype at 9p21.3 was shown to overlap with exons 13 to 19 of ANRIL [2528], which was expressed in atheromatous plaques and served as a functional enhancer of cellular proliferation and inflammation [25, 27]. And, variants on 9p21.3 had a role in regulation of cardiac cyclin dependent kinase inhibitor 2A/2B (CDKN2A/2B) expression by altering the dynamics of vascular cell proliferation [29]. As white blood cells especially neutrophiles, an important cell line in vascular inflammation, were significantly increased in CC genotype carriers in this study, the relationship between 9p21.3 and inflammation might be a possible explanation for angiographic plaque progression. Further functional analyses are needed to clarify possible pathways in which this SNP on chromosome 9p21.3 contributes to development of CAD and plaque progression.

Although diabetic patients had more severe plaque progression than non-diabetic counterparts, risk genotype of rs1333049 was not an independent determinant of plaque progression in diabetes. The difference in association between variant rs1333049 on chromosome 9p21.3 and plaque progression in diabetic and non-diabetic patients suggested that CAD in diabetes might be mediated through a pathway other than polymorphism on 9p21.3, and perhaps the role of other risk factors exceeded that of variants on 9p21.3 in conferring more severe plaque burden for diabetic patients.

This study had several limitations. First, all patients received medical treatments during follow-up, which could affect the natural course of the disease and plaque progression. However, since patients with or without plaque progression received similar medical treatment which was listed in Table 1 and no significant change of medical treatment was made before the result of the follow-up angiography, these could help to decrease the influence of treatment to certain extent. Second, case-control studies had advantages for identifying disease related genes, but they were limited to detect gene-environment interactions [30]. A prospective cohort study is needed to better illustrate the role of genetic and environmental factors as well as their interactions in CAD development.

Conclusions

Polymorphism on chromosome 9p21.3 is significantly associated with CAD in Chinese Han population, and also contributes to coronary plaque progression in non-diabetic patients. Thus, SNP scanning on 9p21.3 should been done to select the patients with potential risk of CAD or angiographic plaque progression in non-diabetic population. Early medical intervention or close follow-up of non-diabetic patients with risk genotype is of equal importance to primary or secondary prevention for CAD in diabetes.

Notes

Declarations

Acknowledgements

This study was supported by a grant from Shanghai High-Tech Foundation.

Authors’ Affiliations

(1)
Department of Cardiology, Rui Jin Hospital, Shanghai Jiaotong University School of Medicine
(2)
Institute of Cardiovascular Diseases, Shanghai Jiaotong University School of Medicine

References

  1. Consortium WTCC: Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls. Nature. 2007, 447 (7145): 661-678. 10.1038/nature05911.View ArticleGoogle Scholar
  2. Newton-Cheh C, Cook NR, VanDenburgh M, Rimm EB, Ridker PM, Albert CM: A common variant at 9p21 is associated with sudden and arrhythmic cardiac death. Circulation. 2009, 120 (21): 2062-2068. 10.1161/CIRCULATIONAHA.109.879049.PubMed CentralView ArticlePubMedGoogle Scholar
  3. Samani NJ, Erdmann J, Hall AS, Hengstenberg C, Mangino M, Mayer B, Dixon RJ, Meitinger T, Braund P, Wichmann HE, Barrett JH, Konig IR, Stevens SE, Szymczak S, Tregouet DA, Iles MM, Pahlke F, Pollard H, Lieb W, Cambien F, Fischer M, Ouwehand W, Blankenberg S, Balmforth AJ, Baessler A, Ball SG, Strom TM, Braenne I, Gieger C, Deloukas P, Tobin MD, Ziegler A, Thompson JR, Schunkert H: Genomewide association analysis of coronary artery disease. N Engl J Med. 2007, 357 (5): 443-453. 10.1056/NEJMoa072366.PubMed CentralView ArticlePubMedGoogle Scholar
  4. Wang Q: Molecular genetics of coronary artery disease. Curr Opin Cardiol. 2005, 20 (3): 182-188. 10.1097/01.hco.0000160373.77190.f1.PubMed CentralView ArticlePubMedGoogle Scholar
  5. McPherson R: Chromosome 9p21 and coronary artery disease. N Engl J Med. 2010, 362 (18): 1736-1737. 10.1056/NEJMcibr1002359.View ArticlePubMedGoogle Scholar
  6. Palomaki GE, Melillo S, Bradley LA: Association between 9p21 genomic markers and heart disease: a meta-analysis. JAMA. 2010, 303 (7): 648-656. 10.1001/jama.2010.118.View ArticlePubMedGoogle Scholar
  7. Shunkert H, Gotz A, Braund P, McGinnis R, Tregouet DA, Mangino M, Linsel-Nitschke P, Cambien F, Hengstenberg C, Stark K, Blankenberg S, Tiret L, Ducimetiere P, Keniry A, Ghori MJ, Schreiber S, El Mokhtari NE, Hall AS, Dixon RJ, Goodall AH, Liptau H, Pollard H, Schwarz DF, Hothorn LA, Wichmann HE, Konig IR, Fischer M, Meisinger C, Ouwehand W, Deloukas P, Thompson JR, Erdmann J, Ziegler A, Samani NJ: Repeated replication and a prospective meta-analysis of the association between chromosome 9p21.3 and coronary artery disease. Circulation. 2008, 117 (13): 1675-1684. 10.1161/CIRCULATIONAHA.107.730614.View ArticleGoogle Scholar
  8. Doria A, Wojcik J, Xu R, Gervino EV, Hauser TH, Johnstone MT, Nolan D, Hu FB, Warram JH: Interaction between poor glycemic control and 9p21 locus on risk of coronary artery disease in type 2 diabetes. JAMA. 2008, 300 (20): 2389-2397. 10.1001/jama.2008.649.PubMed CentralView ArticlePubMedGoogle Scholar
  9. Schunkert H, Gotz A, Braund P, McGinnis R, Tregouet DA, Mangino M, Linsel-Nitschke P, Cambien F, Hengstenberg C, Stark K, Blankenberg S, Tiret L, Ducimetiere P, Keniry A, Ghori MJ, Schreiber S, El Mokhtari NE, Hall AS, Dixon RJ, Goodall AH, Liptau H, Pollard H, Schwarz DF, Hothorn LA, Wichmann HE, Konig IR, Fischer M, Meisinger C, Ouwehand W, Deloukas P, Thompson JR, Erdmann J, Ziegler A, Samani NJ: Coronary artery disease-associated locus on chromosome 9p21 and early markers of atherosclerosis. Arterioscler Thromb Vasc Biol. 2008, 28 (9): 1679-1683. 10.1161/ATVBAHA.108.170332.View ArticlePubMedGoogle Scholar
  10. Silander K, Tang H, Myles S, Jakkula E, Timpson NJ, Cavalli-Sforza L, Peltonen L: Worldwide patterns of haplotype diversity at 9p21.3, a locus associated with type 2 diabetes and coronary heart disease. Genome Med. 2009, 1 (5): 51-10.1186/gm51.PubMed CentralView ArticlePubMedGoogle Scholar
  11. Gori F, Specchia C, Pietri S, Crociati L, Barlera S, Franciosi M, Nicolucci A, Signorini S, Brambilla P, Franzosi MG: Common genetic variants on chromosome 9p21 are associated with myocardial infarction and type 2 diabetes in an Italian population. BMC Med Genet. 2010, 11: 60-10.1186/1471-2156-11-60.PubMed CentralView ArticlePubMedGoogle Scholar
  12. Aronson D, Rayfield EJ: How hyperglycemia promotes atherosclerosis: molecular mechanisms. Cardiovasc Diabetol. 2002, 1: 1-10.1186/1475-2840-1-1.PubMed CentralView ArticlePubMedGoogle Scholar
  13. Pu LJ, Lu L, Xu XW, Zhang RY, Zhang Q, Zhang JS, Hu J, Yang ZK, Ding FH, Chen QJ, Lou S, Shen J, Fang DH, Shen WF: Value of serum glycated albumin and high-sensitivity C-reactive protein levels in the prediction of presence of coronary artery disease in patients with type 2 diabetes. Cardiovasc Diabetol. 2006, 5: 27-10.1186/1475-2840-5-27.PubMed CentralView ArticlePubMedGoogle Scholar
  14. Andersson C, Gislason GH, Weeke P, Hoffmann S, Hansen PR, Torp-Pedersen C, Sogaard P: Diabetes is associated with impaired myocardial performance in patients without significant coronary artery disease. Cardiovasc Diabetol. 2010, 9: 3-10.1186/1475-2840-9-3.PubMed CentralView ArticlePubMedGoogle Scholar
  15. Chen SN, Ballantyne CM, Gotto AM, Marian AJ: The 9p21 susceptibility locus for coronary artery disease and the severity of coronary atherosclerosis. BMC Cardiovasc Disord. 2009, 9: 3-10.1186/1471-2261-9-3.PubMed CentralView ArticlePubMedGoogle Scholar
  16. Peng WH, Lu L, Hu J, Yan XX, Zhang Q, Zhang RY, Chen QJ, Shen WF: Decreased serum esRAGE level is associated with angiographically determined coronary plaque progression in diabetic patients. Clin Biochem. 2009, 42 (12): 1252-1259. 10.1016/j.clinbiochem.2009.04.017.View ArticlePubMedGoogle Scholar
  17. Zheng JL, Lu L, Hu J, Zhang RY, Zhang Q, Chen QJ, Shen WF: Increased serum YKL-40 and C-reactive protein levels are associated with angiographic lesion progression in patients with coronary artery disease. Atherosclerosis. 2009, 210 (2): 590-595. 10.1016/j.atherosclerosis.2009.12.016.View ArticlePubMedGoogle Scholar
  18. Lansky AJ, Desai K, Leon MB: Quantitative coronary angiography in regression trials: a review of methodologic considerations, endpoint selection, and limitations. Am J Cardiol. 2002, 89 (4A): 4B-9B. 10.1016/S0002-9149(01)02326-8.View ArticlePubMedGoogle Scholar
  19. Berry C, L'Allier PL, Gregoire J, Lesperance J, Levesque S, Ibrahim R, Tardif JC: Comparison of intravascular ultrasound and quantitative coronary angiography for the assessment of coronary artery disease progression. Circulation. 2007, 115 (14): 1851-1857. 10.1161/CIRCULATIONAHA.106.655654.View ArticlePubMedGoogle Scholar
  20. Peng WH, Lu L, Zhang Q, Zhang RY, Wang LJ, Yan XX, Chen QJ, Shen WF: Chromosome 9p21 polymorphism is associated with myocardial infarction but not with clinical outcome in Han Chinese. Clin Chem Lab Med. 2009, 47 (8): 917-922. 10.1515/CCLM.2009.215.View ArticlePubMedGoogle Scholar
  21. Ye S, Willeit J, Kronenberg F, Xu Q, Kiechl S: Association of genetic variation on chromosome 9p21 with susceptibility and progression of atherosclerosis: a population-based, prospective study. Journal of the American College of Cardiology. 2008, 52 (5): 378-384. 10.1016/j.jacc.2007.11.087.View ArticlePubMedGoogle Scholar
  22. Hoppmann P, Erl A, Turk S, Tiroch K, Mehilli J, Schomig A, Kastrati A, Koch W: No association of chromosome 9p21.3 variation with clinical and angiographic outcomes after placement of drug-eluting stents. JACC Cardiovasc Interv. 2009, 2 (11): 1149-1155. 10.1016/j.jcin.2009.08.021.View ArticlePubMedGoogle Scholar
  23. Buysschaert I, Carruthers KF, Dunbar DR, Peuteman G, Rietzschel E, Belmans A, Hedley A, De Meyer T, Budaj A, Van de Werf F, Lambrechts D, Fox KA: A variant at chromosome 9p21 is associated with recurrent myocardial infarction and cardiac death after acute coronary syndrome: The GRACE Genetics Study. Eur Heart J. 2010, 31 (9): 1132-1141. 10.1093/eurheartj/ehq053.PubMed CentralView ArticlePubMedGoogle Scholar
  24. Liu KY, Muehlschlegel JD, Perry TE, Fox AA, Collard CD, Body SC, Shernan SK: Common genetic variants on chromosome 9p21 predict perioperative myocardial injury after coronary artery bypass graft surgery. J Thorac Cardiovasc Surg. 2010, 139 (2): 483-488. 10.1016/j.jtcvs.2009.06.032. 488 e481-482PubMed CentralView ArticlePubMedGoogle Scholar
  25. Broadbent HM, Peden JF, Lorkowski S, Goel A, Ongen H, Green F, Clarke R, Collins R, Franzosi MG, Tognoni G, Seedorf U, Rust S, Eriksson P, Hamsten A, Farrall M, Watkins H: Susceptibility to coronary artery disease and diabetes is encoded by distinct, tightly linked SNPs in the ANRIL locus on chromosome 9p. Human molecular genetics. 2008, 17 (6): 806-814. 10.1093/hmg/ddm352.View ArticlePubMedGoogle Scholar
  26. Holdt LM, Beutner F, Scholz M, Gielen S, Gabel G, Bergert H, Schuler G, Thiery J, Teupser D: ANRIL Expression Is Associated With Atherosclerosis Risk at Chromosome 9p21. Arterioscler Thromb Vasc Biol. 2010, 30 (3): 620-627. 10.1161/ATVBAHA.109.196832.View ArticlePubMedGoogle Scholar
  27. Jarinova O, Stewart AF, Roberts R, Wells G, Lau P, Naing T, Buerki C, McLean BW, Cook RC, Parker JS, McPherson R: Functional Analysis of the Chromosome 9p21.3 Coronary Artery Disease Risk Locus. Arterioscler Thromb Vasc Biol. 2009, 29 (10): 1671-1677. 10.1161/ATVBAHA.109.189522.View ArticlePubMedGoogle Scholar
  28. Cunnington MS, Santibanez Koref M, Mayosi BM, Burn J, Keavney B: Chromosome 9p21 SNPs Associated with Multiple Disease Phenotypes Correlate with ANRIL Expression. PLoS Genet. 2010, 6 (4): e1000899-10.1371/journal.pgen.1000899.PubMed CentralView ArticlePubMedGoogle Scholar
  29. Visel A, Zhu Y, May D, Afzal V, Gong E, Attanasio C, Blow MJ, Cohen JC, Rubin EM, Pennacchio LA: Targeted deletion of the 9p21 non-coding coronary artery disease risk interval in mice. Nature. 2010, 464 (7287): 409-412. 10.1038/nature08801.PubMed CentralView ArticlePubMedGoogle Scholar
  30. Manolio TA, Bailey-Wilson JE, Collins FS: Genes, environment and the value of prospective cohort studies. Nat Rev Genet. 2006, 7 (10): 812-820. 10.1038/nrg1919.View ArticlePubMedGoogle Scholar

Copyright

© Wang et al; licensee BioMed Central Ltd. 2010

This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Advertisement