Skip to main content

Table 1 Murine glucose transporter primers

From: GLUT4, GLUT1, and GLUT8 are the dominant GLUT transcripts expressed in the murine left ventricle

  Forward primer Reverse primer Amplicon(bp)
Glut1 TCAACACGGCCTTCACTG CACGATGCTCAGATAGGACATC 164
Glut2 TGTGCTGCTGGATAAATTCGCCTG AACCATGAACCAAGGGATTGGACC 109
Glut3 TTCTGGTCGGAATGCTCTTC AATGTCCTCGAAAGTCCTGC 143
Glut4 GTAACTTCATTGTCGGCATGG AGCTGAGATCTGGTCAAACG 155
Glut5 GGCTCATCTTCCCCTTCATTC ATGAATGTCCTGCCCTTGG 145
Glut6 TTGGTGCTGTGAGGCT TGGCACAAACTGGACGTA 140
Glut8 TTCATGGCCTTTCTAGTGACC GAGTCCTGCCTTTAGTCTCAG 145
Glut9 TGCTTCCTCGTCTTCGCCACAATA CTCTTGGCAAATGCCTGGCTGATT 113
Glut10 ACCAAAGGACAGTCTTTAGCTG ATCTTCCAAGCAGACGGATG 148
Glut12 GGGTGTCAACCTTCTCATCTC CCAAAGAGCATCCCTTAGTCTC 149
Actin GATTACTGCTCTGGCTCCTAG GACTCATCGTACTCCTGCTTG 147
HPRT CCCCAAAATGGTTAAGGTTGC AACAAAGTCTGGCCTGTATCC 76
\