Skip to main content

Table 1 Primers used for the determination by real-time PCR of mRNA concentrations:

From: Lipogenesis in arterial wall and vascular smooth muscular cells: regulation and abnormalities in insulin-resistance

Name Forward primer Reverse primer Size (bp)
In rats    
ACC1 caacgcaggcatcagaa caagtattccacagtccc 138
ChREBP cgggacatgtttgatgactatgtc aataaaggtcggatgaggatgct 86
FAS ggtgctacccattcgtg ggatgtatcattcttggactt 115
Srebp-1c cgctaccgttcctctatcaa ttcgcagggtcaggttctcc 164
VLDLr tctggagttcctagctcat ccagtgaatttattggcacc 108
FAT aggaagtggcaaagaat tgaaggctcaaagatgg 155
LPL cctgaagacacagctgagga cacccaactctcatacattc 141
In mice:    
ACC1 cgctggtcttagaagttga tccctgcygatgtatttgat 149
ChREBP gtccgatatctcgacacactc cattgccaacataagcatgttctg 91
FAS tgctgccgtgtccttctacca gcacccaagtcctcgccata 128
Srebp-1c ggcactaagtgccctcaacct gccacatagatctctctgccagtgt 81
FATP cctgcggcttcaaca tcagtggctccatcgt 84
FAT ggaactgtgggctcattgc catgagaatgcctccaaacac 68
In humans    
ACC1 acatccctacgctaaaca agaacatcgctgacacta 85
ChREBP tcggcaatgctgacatg gaggcgggagttggtaaa 98
FAS acggccctcatttccag tgaagctcacccagttatcc 87
Srebp-1c tgaagacagacggagcca ggactgttgccaagatggtt 120
18S (mice, Rat, human) tgaggccatgattaagaggg agtcggcatcgtttatggtc 190