Skip to main content

Table 1 Nucleotide sequences of DNA primers used for PCR amplification of the HNF4α gene

From: Mutations in the coding regions of the hepatocyte nuclear factor 4 alpha in Iranian families with maturity onset diabetes of the young

Region Sense primer (5'→3') Antisense primer (5'→3') Segment size Tannealing/°C
1 tgtaaaacgacggccagtgggcactgggaggaggcagt caggaaacagctatgacccttggcaacacctgtgctggc 405 bp 75
1b tgtaaaacgacggccagttcatatcagcaacatgtccg caggaaacagctatgaccgggctcttccctccagga 210 bp 73
2 tgtaaaacgacggccagtcttcctgaagcctcactcc caggaaacagctatgacccccaagtgtgcccatttcc 352 bp 75
3 tgtaaaacgacggccagtgttgtgtcttctccatcca caggaaacagctatgaccgcaggtggggcagtggtg 215 bp 56
4 tgtaaaacgacggccagttctccctcctcacctctctg caggaaacagctatgacccctctgtagtgtggggga 226 bp 56
5 tgtaaaacgacggccagtatctccagcattttcttccc caggaaacagctatgacccactgcccactactgccc 267 bp 72
6 tgtaaaacgacggccagtagggtacagatggcaaacac caggaaacagctatgaccaccctccctggagccctg 204 bp 70
7 tgtaaaacgacggccagttgacttcccatcctccctcc caggaaacagctatgaccggagagagagtcagggatgg 268 bp 68
8 tgtaaaacgacggccagtagctggaccctgctgccc caggaaacagctatgacccactccaaccccgcccct 354 bp 74
9 tgtaaaacgacggccagtgcatcccagactctccatcc caggaaacagctatgaccttgcaaggtaaaatcccagag 262 bp 72
10 tgtaaaacgacggccagtagcccctgtctgtctgtttg caggaaacagctatgaccgggactggtcctggcatcac 316 bp 72
Val/Met255 variant ccggagctggcggagatgacccg caggaaacagctatgaccggagagagagtcagggatgg 180 bp 70