Skip to main content

Advertisement

Table 1 List of sequences of PCR primers used

From: Genetic association of glutathione peroxidase-1 with coronary artery calcification in type 2 diabetes: a case control study with multi-slice computed tomography

a.     
  Gene Restriction Enzyme Direction Primers
  CAPN10 (A/G-iSNP43) Nsp I Sense 5' GCTGGCTGGTGACATCAGTG3'
    Antisense 5' TCAGGTTCCATCTTTCTGCCAG3'
  ADRB3 (Try64Arg) Mva I Sense 5' CGCCCAATACC-GCCAACAC3'
    Antisense 5' CCACCAGGAGTCCCATCACC3'
  PPARγ (Pro12Ala) Bst UI Sense 5' GCCAATTCAAGCCCAGTC3'
    Antisense 5'GATATGTTTGCAGACAGTGTATCAGTGAAGGAATCGCTTTCCG3'
  FATP4 (Gly209Ser) Hpa II Sense 5' GTGAGGTCCATGCCAGCCTG3'
    Antisense 5' CACCTGTGAAGCCCTTGGTCAG3'
b.     
  Gene Restriction Enzyme Direction Primers
  GPx-1 (Pro197Leu) Hae III Sense 5' TTATGACCGACCCCAAGCTCA3'
    Antisense 5' ACAGCAGCACTGCAACTGCC3'
  Catalase (SNP-89) Hinf I Sense 5'AATCAGAAGGCAGTCCTCCC3'
    Antisense 5'TCGGGGAGCACAGAGTGTAC3'
  Mn-SOD (Ala16Val) BsaW I Sense 5' GCTGTGCTTTCTCGTCTTCAG3'
    Antisense 5'TGGTACTTCTCCTCGGTGACG 3'
  Cu/Zn-SOD (intron 3) Hha I Sense 5'CTATCCAGAAAACACGGTGGGCC3'
    Antisense 5'ATTGCCCAAGTCTCCAACATGC 3'
  NADPH oxidase (+242) Rsa I Sense 5'ACACTGAGGTAAGTGGGGGTGGCTCCTGT3'
    Antisense 5' TGCTTGTGGGTAAACCAAGGCCGGTG3'
  1. Oligonucleotides used as PCR primers for the detection of each SNP. a) genes associated with the onset of type 2 diabetes and/or insulin resistance. b) genes related to the ROS-scavenging system. Enzymes represent restriction enzymes for detection of each RFLP of PCR product.