Skip to main content

Table 1 List of sequences of PCR primers used

From: Genetic association of glutathione peroxidase-1 with coronary artery calcification in type 2 diabetes: a case control study with multi-slice computed tomography

  Gene Restriction Enzyme Direction Primers
  ADRB3 (Try64Arg) Mva I Sense 5' CGCCCAATACC-GCCAACAC3'
  Gene Restriction Enzyme Direction Primers
  GPx-1 (Pro197Leu) Hae III Sense 5' TTATGACCGACCCCAAGCTCA3'
  Catalase (SNP-89) Hinf I Sense 5'AATCAGAAGGCAGTCCTCCC3'
  Cu/Zn-SOD (intron 3) Hha I Sense 5'CTATCCAGAAAACACGGTGGGCC3'
  1. Oligonucleotides used as PCR primers for the detection of each SNP. a) genes associated with the onset of type 2 diabetes and/or insulin resistance. b) genes related to the ROS-scavenging system. Enzymes represent restriction enzymes for detection of each RFLP of PCR product.