Skip to main content

Advertisement

Table 1 Primers for TNF-α, IL-1β and IL-6 mRNA amplification

From: Neointimal hyperplasia persists at six months after sirolimus-eluting stent implantation in diabetic porcine

Target gene Forward primer (5'-3') Reverse primer(5'-3')
TNF-α ggctgtacctcatctactcc cagcaaagtccagatagtcg
IL-1β gatgaggagtatgagagcga gacaggcttatgttctgcttg
IL-6 gtgagaagtatgagaagtgtga gcaggatgagaatgatctttg
GAPDH acgaccatggagaaggctg tcgtacgaggaaatgagct