Skip to main content

Advertisement

Table 1 Primers used in PCR reactions.

From: Decreased expression of β1- and β2-adrenoceptors in human diabetic atrial appendage

Primer Primer sequence 5'-3' PCR product size (bp) Annealing Temperature (°C) MgCl2 (mM)
β1-ARs (sense) 236CGAGCCGCTGTCTCAGCAGTGGACA260 201 54 1,2
β1-ARs(antisense) 436GGTGGCCCCGAACGGCACCACCAGCA412    
β2-ARs (sense) 2135ACTGCTATGCCAATGAGACC2154 463 59 1,2
β2-ARs(antisense) 2597TGGAAGGCAATCCTGAAATC2578    
β-actin (sense) 1079AAGTACTCCGTGTGGATCGG1098 286 54–59 1,2–1,3
β-actin(antisense) 1364CACCTTCACCGTTCCAGTTT1345    
β-actin (sense) 854CTCTTCCAGCCTTCCTTCCT873 513 54–59 1,2–1,3
β-actin(antisense) 1366GTCACCTTCACCGTTCCAGT1347    
  1. Primers were designed based on published sequences in the National Center for Biotechnology Information GenBank database http://www3.ncbi.nlm.nih.gov/entrez/: β1-ARs accession number NM_000684) [24]; β2-ARs (accession number XM_004030); β-actin (accession number NM_001101). Subscript numbers refer to positions of bases within the published cDNA sequences.