Skip to main content

Table 1 Primer sequences for real-time PCR analysis

From: N-Acetylcysteine prevents congenital heart defects induced by pregestational diabetes

Gene Accession no. Product size Primer sequence (5′→3′)
Nkx2.5 NM_008700.2 162 F: GACAGCGGCAGGACCAGACT
R: CGTTGTAGCCATAGGCATTG
Vegfa NM_001025257.3 194 F: GATTGAGACCCTGGTGGACAT
R: TCTCCTATGTGCTGGCTTTGG
Gata4 NM_008092.3 134 F: GCCTGCGATGTCTGAGTGAC
R: CACTATGGGCACAGCAGCTC
Gata5 NM_008093.2 167 F: ACCCCACAACCTACCCAGCA
R: GCCCTCACCAGGGAACTCCT
Bmp4 NM_007554.2 250 F: GTTATGAAGCCCCCAGCAGA
R: CCCAATCTCCACTCCCTTGA
Tbx5 NM_011537.3 103 F: AGGAGCACAGTGAGGCACAA
R: GGGCCAGAGACACCATTCTC
Tgf-β1 NM_011577.1 120 F: GCCCGAAGCGGACTACTATG
R: CACTGCTTCCCGAATGTCTG
28S NR_003279.1 178 F: GGGCCACTTTTGGTAAGCAG
R: TTGATTCGGCAGGTGAGTTG
Cyclin D1 NM_007631.2 135 F: CTGACACCAATCTCCTCAACG
R: CTCACAGACCTCCAGCATCCA
Mef2c NM_001170537.1 405 F: CACCGAGTACAACGAGCCGCA
R: CTGGTGCCTGCACCGGATGTC
  1. F: forward primer, R: reverse primer.