Skip to main content

Table 1 Primers for Real- time PCR

From: Protein kinase RNA- like endoplasmic reticulum kinase (PERK) signaling pathway plays a major role in reactive oxygen species (ROS)- mediated endoplasmic reticulum stress- induced apoptosis in diabetic cardiomyopathy

Gene Primer   Sequence Size
GRP78 Forward 5′ TCAGCCCACCGTAACAAT 3′ 275
Reverse 5′ CAAACTTCTCGGCGTCAT 3′
ATF-4 Forward 5′ CACTAGGTACCGCCAGAAGAAGA 3′ 140
Reverse 5′ AATCCGCCCTCTCTTTTAGAG 3′  
CHOP Forward 5′ AGCTGAGTCTCTGCCTTTCG 3′ 456
Reverse 5′ TGTGGTCTC TACCTCCCTGG 3′  
β- Actin Forward 5′ TGGCACCCAGCACAATGAA 3′ 186
Reverse 5′ CTAAGTCATAGTCCGCCTAGAAGCA 3′