Skip to main content

Table 1 Primer sequences and size of Realtime PCR products

From: RhoA/ROCK-dependent moesin phosphorylation regulates AGE-induced endothelial cellular response

Gene Primer Product size (bp)
moesin
surrounding primer
5' TAAACTTCGCCAACTCCGC 3' 2114
  5' TCCACACTTGACTCCCATAGG 3'  
moesin
clone primer
5' CTAGAATTCGCGCCCAAAACGATCAGTGTG 3' 1735
  5' GCGCTCGAGTTACATAGACTCAAATTCGTC 3'  
moesin
realtime primer
5' GATGTGCGGAAGGAAAGC 3' 158
  5' GTCTCAGGCGGGCAGTAA 3'  
GAPDH 5' GCACCGTCAAGGCTGAGAAC 3' 138
  5' TGGTGAAGACGCCAGTGGA 3'