Skip to main content

Table 1 Sequence of RT-PCR primer pairs for analyzed genes

From: Regional evidence of modulation of cardiac adiponectin level in dilated cardiomyopathy: pilot study in a porcine animal model

Primer GenBank Sequence Ta, °C Cycles, n
ADN EF601160.1 Forward: ATCTGGAGTGACTGGGGTTG 61 36
202 bp Reverse: TTTGCCAGTGGTGACATCAT
AdipoR1 AB527058.1 Forward: AACCCACCCAAAGCTGAAGA 58 29
334 bp Reverse: CTGAGCATGGTCAAGATTCC
AdipoR2 NM_001007192 Forward: GCCTGGGGATCTTTTATATGTTTC 53 34
650 bp Reverse: GCCGATCATGAAACGAA
T-CAD NM_001109945.1 Forward: CCCGGGCAGAGCTTCGAAAT 64 25
217 bp Reverse: GGTAGAAAACCGGGCCCTCG
PPAR-α NM_001044526.1 Forward: TCGCGGGAAAGGCCAGCAAT 70 27
431 bp Reverse: GTCGTCCAGCTCCAGCGCATT
PPAR-γ DQ437884.1 Forward: AGGAGCATAGCAAAGAGGTGGCC 70 32
391 bp Reverse: AGCAAACCTGGGCGGTCTCCA
BNP M25547 Forward: GTGCTCCTGCTCCTGTTCTT 61 35
451 bp Reverse: TCCCAGGCTTCTGTGAGG
iNOS NM_001143690.1 Forward: GAGGGCAGCCAAGGCCCAAG 65 35
264 bp Reverse: GGCCAGCTTTCGGAGCAGCA
TNF-α EU682384.1 Forward: ATCGGCCCCCAGAAGGAAGAC 64 33
351 bp Reverse: GATGGCAGAGAGGAGGTTGAC
GAPDH AF017079 Forward: ACCACAGTCCATGCCATCAC 60 30
451 bp Reverse: TCCACCACCCTGTTGCTGTA
HPRT1 DQ178126 Forward: CCGAGGATTTGGAAAAGGT 60 30
181 bp Reverse: CTATTTCTGTTCAGTGCTTTGATGT
TBP DQ178129 Forward: GATGGACGTTCGGTTTAGG 60 30
124 bp Reverse: AGCAGCACAGTACGAGCAA
  1. Adiponectin (ADN), AdipoR1, AdipoR2, T-cadherin (T-CAD), peroxisome proliferator-activated receptor (PPAR)-α, PPAR-γ, brain natriuretic peptides (BNP), inducible nitric oxide synthase (iNOS), tumor necrosis factor (TNF)-α, glyceraldehyde 3-phosphate dehydrogenase (GAPDH), hypoxanthine phosphoribosyltransferase 1 (HPRT-1) and TATA binding protein (TBP).