Skip to main content

Table 2 Primers for real-time PCR analysis

From: Reduction of n-3 PUFAs, specifically DHA and EPA, and enhancement of peroxisomal beta-oxidation in type 2 diabetic rat heart

Gene Forward primer Reverse primer Product (bp)
18S CGCCGCTAGAGGTGAAATTC CCAGTCGGCATCGTTTATGG 149
PPARα TGGAGTCCACGCATGTGAAG TGTTCCGGTTCTTTTTCTGAATCT 113
m-CPT1 AAACATCACTGCCCAAGC ACTCCATGCGGAAATAGG 108
ACOX1 GTTGATCACGCACATCTTGGA TCGTTCAGAATCAAGTTCTCAATTTC 78
ACOX3 TGGAGAAGGAACGAGAACTGAAC ACATGTGGAGGACACATTTGTTG 165
LBP TTTTAAAATGGGACCCTTCAGAGT CCCCTTGCGAATTTTCCAA 70
DBP GGTGGTAAAGAAAGTAAATG AATTGTGATGGTCGTGTC 148
THLA GGTATGAGATCAATGCTGCC GGTGCATTTGGACATTTGTAG 131
THLB GGCACAAGGGCATCCAATC GTGCGCTGTCTTTGGTTCAA 51
SCPx TATGGAATGTCTGCCTGTCC CCAGTGCTTCATAAGTCAGG 510